Product Details

SNP ID: rs111564291
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:88715803 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTGCGAGATCTCGCTGAAGAATCC[A/G]CGCACGAACTTGCCGATGACCAGCA
Phenotype: MIM: 611184
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CTU2 PubMed Links

Gene Details

Gene: CTU2
Gene Name: cytosolic thiouridylase subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001012759.2	7624	Intron			NP_001012777.1
NM_001012762.2	7624	Intron			NP_001012780.1
NM_001318507.1	7624	Intron			NP_001305436.1
NM_001318513.1	7624	Intron			NP_001305442.1
XM_017023210.1	7624	Intron			XP_016878699.1

Gene: MIR4722
Gene Name: microRNA 4722

There are no transcripts associated with this gene.

Gene: PIEZO1
Gene Name: piezo type mechanosensitive ion channel component 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142864.3	7624	Silent Mutation	CGC,CGT	R2456R	NP_001136336.2

Gene: RNF166
Gene Name: ring finger protein 166

There are no transcripts associated with this gene.

View Full Product Details