Product Details

SNP ID: rs115889730
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:82021908 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGACACCCCCCGCCCCCCACGCCTG[C/T]TGCCTTGGGTGATAAAGAAGGGCCT
Phenotype: MIM: 606236 MIM: 602050 MIM: 615128
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ASPSCR1 PubMed Links

Gene Details

Gene: ASPSCR1
Gene Name: ASPSCR1, UBX domain containing tether for SLC2A4

There are no transcripts associated with this gene.

Gene: LRRC45
Gene Name: leucine rich repeat containing 45

There are no transcripts associated with this gene.

Gene: RAC3
Gene Name: ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3)

There are no transcripts associated with this gene.

Gene: STRA13
Gene Name: stimulated by retinoic acid 13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271006.1		Intron			NP_001257935.1
NM_001271007.1		Intron			NP_001257936.1
NM_144998.3		Intron			NP_659435.2
XM_005256339.2		Intron			XP_005256396.1
XM_017024326.1		Intron			XP_016879815.1
XM_017024327.1		Intron			XP_016879816.1
XM_017024328.1		Intron			XP_016879817.1
XM_017024329.1		Intron			XP_016879818.1

View Full Product Details