Product Details

SNP ID: rs116004401
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:760215 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTTATTGTGTTTGGCAAACCACTC[A/G]TCACTTTTATCTGCTGCCATTGCCT
Phenotype: MIM: 606969
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DBIL5P PubMed Links

Gene Details

Gene: DBIL5P
Gene Name: diazepam binding inhibitor-like 5, pseudogene

There are no transcripts associated with this gene.

Gene: GEMIN4
Gene Name: gem nuclear organelle associated protein 4

There are no transcripts associated with this gene.

Gene: GLOD4
Gene Name: glyoxalase domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016080.3	953	Silent Mutation	GAC,GAT	D285D	NP_057164.3
XM_006721540.2	953	Silent Mutation	GAC,GAT	D276D	XP_006721603.1
XM_017024711.1	953	Silent Mutation	GAC,GAT	D276D	XP_016880200.1
XM_017024712.1	953	Silent Mutation	GAC,GAT	D229D	XP_016880201.1

View Full Product Details