Product Details

SNP ID: rs113538531
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7014147 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTGCTTCATTCCCACCCCCAGGA[A/G]TGGCCCCCAGAACATATACAACCTT
Phenotype: MIM: 152391 MIM: 608992 MIM: 610718 MIM: 615672
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ALOX12 PubMed Links

Gene Details

Gene: ALOX12
Gene Name: arachidonate 12-lipoxygenase, 12S type

There are no transcripts associated with this gene.

Gene: ALOX12-AS1
Gene Name: ALOX12 antisense RNA 1

There are no transcripts associated with this gene.

Gene: BCL6B
Gene Name: B-cell CLL/lymphoma 6B

There are no transcripts associated with this gene.

Gene: C17orf49
Gene Name: chromosome 17 open reading frame 49

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142798.2	425	Intron			NP_001136270.1
NM_001142799.2	425	Intron			NP_001136271.1
NM_174893.3	425	Intron			NP_777553.1

Gene: MIR195
Gene Name: microRNA 195

There are no transcripts associated with this gene.

Gene: MIR497
Gene Name: microRNA 497

There are no transcripts associated with this gene.

Gene: MIR497HG
Gene Name: mir-497-195 cluster host gene

There are no transcripts associated with this gene.

Gene: RNASEK
Gene Name: ribonuclease K

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001004333.4	425	Missense Mutation	AAT,AGT	N92S	NP_001004333.2

Gene: RNASEK-C17orf49
Gene Name: RNASEK-C17orf49 readthrough

There are no transcripts associated with this gene.

View Full Product Details