Product Details
- SNP ID
-
rs112528052
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:44177001 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTCCTGGAGGCTGGAGCTGATGCCC[A/G]GGCGGCCGGGCGCAAGCGCCACACG
- Phenotype
-
MIM: 615056
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ASB16
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs7212573,rs7212854] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ASB16
- Gene Name
- ankyrin repeat and SOCS box containing 16
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_080863.4 |
917 |
Missense Mutation |
CAG,CGG |
Q278R |
NP_543139.4 |
- Gene
- ASB16-AS1
- Gene Name
- ASB16 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- TMUB2
- Gene Name
- transmembrane and ubiquitin like domain containing 2
There are no transcripts associated with this gene.
View Full Product Details