Product Details

SNP ID

rs115874895

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.18:48029485 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCTCCTCGAACTGCCGCTCCAGCTC[C/T]TGCAGGCTCAGGGCGCCCTTGGGCG

Phenotype

MIM: 616591

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

ZBTB7C PubMed Links

Additional Information

For this assay, SNP(s) [rs7231151] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ZBTB7C

Gene Name

zinc finger and BTB domain containing 7C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039360.2	2348	Silent Mutation	CAA,CAG	Q545Q	NP_001034449.1
NM_001318841.1	2348	Silent Mutation	CAA,CAG	Q545Q	NP_001305770.1
XM_005258229.4	2348	Silent Mutation	CAA,CAG	Q545Q	XP_005258286.1
XM_011525861.2	2348	Silent Mutation	CAA,CAG	Q594Q	XP_011524163.1
XM_011525863.2	2348	Silent Mutation	CAA,CAG	Q554Q	XP_011524165.1
XM_011525864.2	2348	Silent Mutation	CAA,CAG	Q554Q	XP_011524166.1
XM_011525865.2	2348	Silent Mutation	CAA,CAG	Q554Q	XP_011524167.1
XM_011525866.2	2348	Silent Mutation	CAA,CAG	Q554Q	XP_011524168.1
XM_011525867.2	2348	Silent Mutation	CAA,CAG	Q554Q	XP_011524169.1
XM_011525869.2	2348	Silent Mutation	CAA,CAG	Q553Q	XP_011524171.1
XM_011525870.2	2348	Silent Mutation	CAA,CAG	Q545Q	XP_011524172.1
XM_011525871.2	2348	Silent Mutation	CAA,CAG	Q545Q	XP_011524173.1
XM_017025605.1	2348	Silent Mutation	CAA,CAG	Q594Q	XP_016881094.1
XM_017025606.1	2348	Silent Mutation	CAA,CAG	Q554Q	XP_016881095.1
XM_017025607.1	2348	Silent Mutation	CAA,CAG	Q554Q	XP_016881096.1
XM_017025608.1	2348	Silent Mutation	CAA,CAG	Q553Q	XP_016881097.1
XM_017025609.1	2348	Silent Mutation	CAA,CAG	Q545Q	XP_016881098.1

View Full Product Details