Product Details

SNP ID
rs116808638
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.19:9757595 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTCCAGTGTGAGTTCGTGTGTGAAC[A/G]TTAAGGTATGTGGAATACCTGAAGG
Phenotype
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
ZNF846 PubMed Links
Additional Information
For this assay, SNP(s) [rs10420364] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ZNF846
Gene Name
zinc finger protein 846
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001077624.1 2453 Silent Mutation AAC,AAT N494N NP_001071092.1
XM_005259772.3 2453 Silent Mutation AAC,AAT N494N XP_005259829.1
XM_005259773.4 2453 Silent Mutation AAC,AAT N493N XP_005259830.1
XM_005259775.3 2453 Silent Mutation AAC,AAT N493N XP_005259832.1
XM_006722658.3 2453 Intron XP_006722721.1
XM_011527717.2 2453 Silent Mutation AAC,AAT N494N XP_011526019.1
XM_011527718.2 2453 Silent Mutation AAC,AAT N493N XP_011526020.1
XM_011527719.2 2453 Silent Mutation AAC,AAT N458N XP_011526021.1
XM_011527720.2 2453 Silent Mutation AAC,AAT N458N XP_011526022.1
XM_011527721.2 2453 Silent Mutation AAC,AAT N437N XP_011526023.1
XM_017026404.1 2453 Silent Mutation AAC,AAT N480N XP_016881893.1
XM_017026405.1 2453 Silent Mutation AAC,AAT N365N XP_016881894.1
XM_017026406.1 2453 Silent Mutation AAC,AAT N365N XP_016881895.1
XM_017026407.1 2453 Intron XP_016881896.1
XM_017026408.1 2453 Intron XP_016881897.1

View Full Product Details