Product Details

SNP ID: rs112205018
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 17
Location: Chr.21:44637505 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCCCAGAGAGCTGCTGCGAGCCC[A/T]GCTGCTGTGCCCCAGCCCCCAGCTT
Phenotype: MIM: 612920
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: KRTAP10-10 PubMed Links

Gene Details

Gene: KRTAP10-10
Gene Name: keratin associated protein 10-10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181688.2		Intron			NP_859016.1

Gene: KRTAP10-11
Gene Name: keratin associated protein 10-11

There are no transcripts associated with this gene.

Gene: KRTAP10-9
Gene Name: keratin associated protein 10-9

There are no transcripts associated with this gene.

Gene: TSPEAR
Gene Name: thrombospondin type laminin G domain and EAR repeats

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272037.1		Intron			NP_001258966.1
NM_144991.2		Intron			NP_659428.2

View Full Product Details