Product Details

SNP ID
rs117902141
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.4:145680420 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ATTTTCTTTTAGAGCAGGACAGCAT[G/T]AGCCTGAGTGTAAACAGTAAGATTT
Phenotype
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
C4orf51 PubMed Links
Additional Information
For this assay, SNP(s) [rs7683750] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
C4orf51
Gene Name
chromosome 4 open reading frame 51
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001080531.1 318 Nonsense Mutation GAG,TAG E73* NP_001074000.1
XM_006714289.3 318 Nonsense Mutation GAG,TAG E73* XP_006714352.1
XM_011532196.2 318 Nonsense Mutation GAG,TAG E73* XP_011530498.1
XM_011532197.2 318 Nonsense Mutation GAG,TAG E73* XP_011530499.1
XM_017008547.1 318 Nonsense Mutation GAG,TAG E73* XP_016864036.1
XM_017008548.1 318 Nonsense Mutation GAG,TAG E73* XP_016864037.1
XM_017008549.1 318 Nonsense Mutation GAG,TAG E73* XP_016864038.1
XM_017008550.1 318 Nonsense Mutation GAG,TAG E73* XP_016864039.1
XM_017008551.1 318 Nonsense Mutation GAG,TAG E73* XP_016864040.1
XM_017008552.1 318 Nonsense Mutation GAG,TAG E73* XP_016864041.1
XM_017008553.1 318 Nonsense Mutation GAG,TAG E73* XP_016864042.1
XM_017008554.1 318 Nonsense Mutation GAG,TAG E73* XP_016864043.1
XM_017008555.1 318 Nonsense Mutation GAG,TAG E73* XP_016864044.1
XM_017008556.1 318 Nonsense Mutation GAG,TAG E73* XP_016864045.1

View Full Product Details