Product Details

SNP ID: rs115258065
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49724332 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTTTATTTTTGACATACACGACCT[C/G]AGACACAAGCGGGGCGGGCAGCGCT
Phenotype: MIM: 615691 MIM: 615320 MIM: 606991 MIM: 614472
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AMIGO3 PubMed Links

Gene Details

Gene: AMIGO3
Gene Name: adhesion molecule with Ig like domain 3

There are no transcripts associated with this gene.

Gene: GMPPB
Gene Name: GDP-mannose pyrophosphorylase B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_013334.3	4769	Intron			NP_037466.2
NM_021971.2	4769	Intron			NP_068806.1

Gene: IP6K1
Gene Name: inositol hexakisphosphate kinase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006115.2	4769	UTR 3			NP_001006115.1
NM_001242829.1	4769	UTR 3			NP_001229758.1
NM_153273.3	4769	UTR 3			NP_695005.1

Gene: RNF123
Gene Name: ring finger protein 123

There are no transcripts associated with this gene.

View Full Product Details