Product Details

SNP ID: rs115355405
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49803410 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCATGGACATGCACAGCGCTCGGCT[C/T]GACAGCTTCCTTAGCCAGCTCCGCT
Phenotype: MIM: 191325
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CDHR4 PubMed Links

Gene Details

Gene: CDHR4
Gene Name: cadherin related family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001007540.3	157	Intron			NP_001007541.2
XM_011533700.2	157	Intron			XP_011532002.1
XM_011533701.2	157	Intron			XP_011532003.1
XM_017006366.1	157	Intron			XP_016861855.1
XM_017006367.1	157	Intron			XP_016861856.1
XM_017006368.1	157	Intron			XP_016861857.1
XM_017006369.1	157	Intron			XP_016861858.1
XM_017006370.1	157	Intron			XP_016861859.1
XM_017006371.1	157	Intron			XP_016861860.1

Gene: FAM212A
Gene Name: family with sequence similarity 212 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_203370.1	157	Silent Mutation	CTC,CTT	L8L	NP_976248.1
XM_017006372.1	157	Intron			XP_016861861.1

Gene: MIR5193
Gene Name: microRNA 5193

There are no transcripts associated with this gene.

Gene: UBA7
Gene Name: ubiquitin like modifier activating enzyme 7

There are no transcripts associated with this gene.

View Full Product Details