Product Details

SNP ID: rs112023020
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50269313 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGGCAGTGGGGCTGGGGAGTGCC[A/G]CCCCCAGCCCCCCACGCCTTCGGCT
Phenotype: MIM: 139360 MIM: 601281
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GNAI2 PubMed Links

Gene Details

Gene: GNAI2
Gene Name: G protein subunit alpha i2

There are no transcripts associated with this gene.

Gene: LSMEM2
Gene Name: leucine rich single-pass membrane protein 2

There are no transcripts associated with this gene.

Gene: MIR6872
Gene Name: microRNA 6872

There are no transcripts associated with this gene.

Gene: SEMA3B
Gene Name: semaphorin 3B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005914.2	365	Missense Mutation	ACC,GCC	T25A	NP_001005914.1
NM_001290060.1	365	Missense Mutation	ACC,GCC	T25A	NP_001276989.1
NM_001290061.1	365	Missense Mutation	ACC,GCC	T25A	NP_001276990.1
NM_001290062.1	365	Intron			NP_001276991.1
NM_001290063.1	365	Intron			NP_001276992.1
NM_004636.3	365	Missense Mutation	ACC,GCC	T25A	NP_004627.1

Gene: SEMA3B-AS1
Gene Name: SEMA3B antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

View Full Product Details