Product Details

SNP ID
rs114632967
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.5:179616160 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCATGCTGCTCTGGCCACCGTAGCC[A/G]CCTCCGTAACCCCCACTCAGCTGCT
Phenotype
MIM: 601035 MIM: 610327
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
HNRNPH1 PubMed Links

Gene Details

Gene
HNRNPH1
Gene Name
heterogeneous nuclear ribonucleoprotein H1 (H)
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001257293.1 1221 Silent Mutation GGC,GGT G422G NP_001244222.1
NM_005520.2 1221 Intron NP_005511.1
XM_005265895.2 1221 Silent Mutation GGC,GGT G422G XP_005265952.1
XM_005265896.2 1221 Silent Mutation GGC,GGT G422G XP_005265953.1
XM_005265901.1 1221 Silent Mutation GGC,GGT G221G XP_005265958.1
XM_005265902.4 1221 Silent Mutation GGC,GGT G221G XP_005265959.1
XM_006714862.2 1221 Silent Mutation GGC,GGT G402G XP_006714925.1
XM_006714863.2 1221 Silent Mutation GGC,GGT G402G XP_006714926.1
XM_011534542.1 1221 Silent Mutation GGC,GGT G422G XP_011532844.1
XM_011534544.1 1221 Silent Mutation GGC,GGT G422G XP_011532846.1
XM_011534545.1 1221 Silent Mutation GGC,GGT G422G XP_011532847.1
XM_011534546.1 1221 Silent Mutation GGC,GGT G422G XP_011532848.1
XM_011534547.1 1221 Silent Mutation GGC,GGT G412G XP_011532849.1
XM_017009414.1 1221 Silent Mutation GGC,GGT G402G XP_016864903.1
XM_017009415.1 1221 Silent Mutation GGC,GGT G422G XP_016864904.1
XM_017009416.1 1221 Silent Mutation GGC,GGT G422G XP_016864905.1
XM_017009417.1 1221 Silent Mutation GGC,GGT G422G XP_016864906.1
XM_017009418.1 1221 Silent Mutation GGC,GGT G412G XP_016864907.1
XM_017009419.1 1221 Silent Mutation GGC,GGT G402G XP_016864908.1
XM_017009420.1 1221 Silent Mutation GGC,GGT G201G XP_016864909.1
XM_017009421.1 1221 Silent Mutation GGC,GGT G221G XP_016864910.1
XM_017009422.1 1221 Silent Mutation GGC,GGT G221G XP_016864911.1
XM_017009423.1 1221 Silent Mutation GGC,GGT G211G XP_016864912.1
XM_017009424.1 1221 Silent Mutation GGC,GGT G239G XP_016864913.1
XM_017009425.1 1221 Intron XP_016864914.1
Gene
RUFY1
Gene Name
RUN and FYVE domain containing 1
There are no transcripts associated with this gene.

View Full Product Details