Product Details

SNP ID

rs114976119

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.5:179616202 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCAGCTGCTGGCTGGCTGGGCCCCC[A/G]TAGCTGGACTGGTTTGCTGTTAAGT

Phenotype

MIM: 601035 MIM: 610327

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

HNRNPH1 PubMed Links

Gene Details

Gene

HNRNPH1

Gene Name

heterogeneous nuclear ribonucleoprotein H1 (H)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001257293.1	1179	Silent Mutation	TAC,TAT	Y408Y	NP_001244222.1
NM_005520.2	1179	Intron			NP_005511.1
XM_005265895.2	1179	Silent Mutation	TAC,TAT	Y408Y	XP_005265952.1
XM_005265896.2	1179	Silent Mutation	TAC,TAT	Y408Y	XP_005265953.1
XM_005265901.1	1179	Silent Mutation	TAC,TAT	Y207Y	XP_005265958.1
XM_005265902.4	1179	Silent Mutation	TAC,TAT	Y207Y	XP_005265959.1
XM_006714862.2	1179	Silent Mutation	TAC,TAT	Y388Y	XP_006714925.1
XM_006714863.2	1179	Silent Mutation	TAC,TAT	Y388Y	XP_006714926.1
XM_011534542.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_011532844.1
XM_011534544.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_011532846.1
XM_011534545.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_011532847.1
XM_011534546.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_011532848.1
XM_011534547.1	1179	Silent Mutation	TAC,TAT	Y398Y	XP_011532849.1
XM_017009414.1	1179	Silent Mutation	TAC,TAT	Y388Y	XP_016864903.1
XM_017009415.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_016864904.1
XM_017009416.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_016864905.1
XM_017009417.1	1179	Silent Mutation	TAC,TAT	Y408Y	XP_016864906.1
XM_017009418.1	1179	Silent Mutation	TAC,TAT	Y398Y	XP_016864907.1
XM_017009419.1	1179	Silent Mutation	TAC,TAT	Y388Y	XP_016864908.1
XM_017009420.1	1179	Silent Mutation	TAC,TAT	Y187Y	XP_016864909.1
XM_017009421.1	1179	Silent Mutation	TAC,TAT	Y207Y	XP_016864910.1
XM_017009422.1	1179	Silent Mutation	TAC,TAT	Y207Y	XP_016864911.1
XM_017009423.1	1179	Silent Mutation	TAC,TAT	Y197Y	XP_016864912.1
XM_017009424.1	1179	Silent Mutation	TAC,TAT	Y225Y	XP_016864913.1
XM_017009425.1	1179	Intron			XP_016864914.1

Gene

RUFY1

Gene Name

RUN and FYVE domain containing 1

There are no transcripts associated with this gene.

View Full Product Details