Product Details

SNP ID: rs111296843
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137243763 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCCCTCCGGGTGCTGTTGCCGAA[C/T]GTCAGGGCGTAGTTGTCCTGCATGG
Phenotype: MIM: 609826 MIM: 602660
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C9orf173-AS1 PubMed Links

Gene Details

Gene: C9orf173-AS1
Gene Name: C9orf173 antisense RNA 1

There are no transcripts associated with this gene.

Gene: FAM166A
Gene Name: family with sequence similarity 166 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001710.2	1808	Silent Mutation	ACA,ACG	T297T	NP_001001710.1
XM_006717108.2	1808	Silent Mutation	ACA,ACG	T281T	XP_006717171.2
XM_011518694.1	1808	Silent Mutation	ACA,ACG	T332T	XP_011516996.1
XM_011518695.1	1808	Silent Mutation	ACA,ACG	T294T	XP_011516997.1
XM_011518696.2	1808	Intron			XP_011516998.1
XM_011518697.1	1808	Intron			XP_011516999.1
XM_017014718.1	1808	Silent Mutation	ACA,ACG	T210T	XP_016870207.1

Gene: SLC34A3
Gene Name: solute carrier family 34 member 3

There are no transcripts associated with this gene.

Gene: STPG3
Gene Name: sperm-tail PG-rich repeat containing 3

There are no transcripts associated with this gene.

Gene: TUBB4B
Gene Name: tubulin beta 4B class IVb

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006088.5	1808	Intron			NP_006079.1

View Full Product Details