Product Details

SNP ID: rs111927058
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137252441 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTCCATCCTCCAACTACAGAGGG[C/T]GGTGGCCGCAGGGCATGGCAGACTT
Phenotype: MIM: 611180 MIM: 602660
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C9orf173-AS1 PubMed Links

Gene Details

Gene: C9orf173-AS1
Gene Name: C9orf173 antisense RNA 1

There are no transcripts associated with this gene.

Gene: FAM166A
Gene Name: family with sequence similarity 166 member A

There are no transcripts associated with this gene.

Gene: NELFB
Gene Name: negative elongation factor complex member B

There are no transcripts associated with this gene.

Gene: STPG3
Gene Name: sperm-tail PG-rich repeat containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001004353.3	434	Silent Mutation	GGC,GGT	G136G	NP_001004353.2
NM_001256699.1	434	Silent Mutation	GGC,GGT	G136G	NP_001243628.1
NM_001256700.1	434	Silent Mutation	GGC,GGT	G136G	NP_001243629.1
NM_001256701.1	434	Silent Mutation	GGC,GGT	G136G	NP_001243630.1
XM_006717113.2	434	Silent Mutation	GGC,GGT	G136G	XP_006717176.1
XM_006717115.2	434	Silent Mutation	GGC,GGT	G136G	XP_006717178.1

Gene: TUBB4B
Gene Name: tubulin beta 4B class IVb

There are no transcripts associated with this gene.

View Full Product Details