Product Details

SNP ID: rs115151103
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:22921403 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAAGAGAAAGGCATGAAAGCCTGAG[A/G]TAGGAAAGAAGATAGACAATTAGAA
Phenotype: MIM: 604045
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC101926933 PubMed Links

Gene Details

Gene: LOC101926933
Gene Name: uncharacterized LOC101926933

There are no transcripts associated with this gene.

Gene: PRMT5
Gene Name: protein arginine methyltransferase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039619.2		Intron			NP_001034708.1
NM_001282953.1		Intron			NP_001269882.1
NM_001282954.1		Intron			NP_001269883.1
NM_001282955.1		Intron			NP_001269884.1
NM_001282956.1		Intron			NP_001269885.1
NM_006109.4		Intron			NP_006100.2
XM_017020927.1		Intron			XP_016876416.1

Gene: PRMT5-AS1
Gene Name: PRMT5 antisense RNA 1

There are no transcripts associated with this gene.

Gene: RBM23
Gene Name: RNA binding motif protein 23

There are no transcripts associated with this gene.

View Full Product Details