Product Details

SNP ID: rs113495940
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:53300260 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAGACACCGATATGACCATCACCA[A/G]AGGTAGGTTCTCAGATACCATTTAT
Phenotype: MIM: 605378 MIM: 611366 MIM: 604143 MIM: 604899
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AAAS PubMed Links

Gene Details

Gene: AAAS
Gene Name: aladin WD repeat nucleoporin

There are no transcripts associated with this gene.

Gene: C12orf10
Gene Name: chromosome 12 open reading frame 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021640.3	379	Silent Mutation	CAA,CAG	Q109Q	NP_067653.3

Gene: ESPL1
Gene Name: extra spindle pole bodies like 1, separase

There are no transcripts associated with this gene.

Gene: PFDN5
Gene Name: prefoldin subunit 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002624.3	379	Intron			NP_002615.2
NM_145897.2	379	Intron			NP_665904.1

View Full Product Details