Product Details

SNP ID

rs112162917

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.12:99648394 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGCCCGAATGGTAACAATGGGCATC[A/G]TTCGCACCAGCCCCTGCCTCACACT

Phenotype

MIM: 607815

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

ANKS1B PubMed Links

Additional Information

For this assay, SNP(s) [rs11109969] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ANKS1B

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204065.1	645	Intron			NP_001190994.1
NM_001204066.1	645	Intron			NP_001190995.1
NM_001204067.1	645	Intron			NP_001190996.1
NM_001204068.1	645	Intron			NP_001190997.1
NM_001204069.1	645	Intron			NP_001190998.1
NM_001204070.1	645	Intron			NP_001190999.1
NM_001204079.1	645	Intron			NP_001191008.1
NM_001204080.1	645	Intron			NP_001191009.1
NM_001204081.1	645	Intron			NP_001191010.1
NM_020140.3	645	Intron			NP_064525.1
NM_152788.4	645	Intron			NP_690001.3
NM_181670.3	645	Intron			NP_858056.2
XM_005269028.4	645	Intron			XP_005269085.1
XM_005269029.4	645	Intron			XP_005269086.1
XM_005269032.3	645	Intron			XP_005269089.1
XM_006719504.3	645	Intron			XP_006719567.1
XM_006719505.3	645	Intron			XP_006719568.1
XM_006719506.3	645	Intron			XP_006719569.1
XM_006719507.3	645	Intron			XP_006719570.1
XM_006719508.3	645	Intron			XP_006719571.1
XM_006719509.3	645	Intron			XP_006719572.1
XM_006719510.3	645	Intron			XP_006719573.1
XM_006719512.3	645	Intron			XP_006719575.1
XM_006719513.3	645	Intron			XP_006719576.1
XM_006719514.3	645	Intron			XP_006719577.1
XM_011538571.2	645	Intron			XP_011536873.1
XM_017019651.1	645	Intron			XP_016875140.1
XM_017019652.1	645	Intron			XP_016875141.1
XM_017019653.1	645	Intron			XP_016875142.1
XM_017019654.1	645	Intron			XP_016875143.1
XM_017019655.1	645	Intron			XP_016875144.1
XM_017019656.1	645	Intron			XP_016875145.1
XM_017019657.1	645	Intron			XP_016875146.1
XM_017019658.1	645	Intron			XP_016875147.1
XM_017019659.1	645	Intron			XP_016875148.1
XM_017019660.1	645	Intron			XP_016875149.1
XM_017019661.1	645	Intron			XP_016875150.1
XM_017019662.1	645	Intron			XP_016875151.1
XM_017019663.1	645	Intron			XP_016875152.1
XM_017019664.1	645	Intron			XP_016875153.1
XM_017019665.1	645	Intron			XP_016875154.1

Gene

FAM71C

Gene Name

family with sequence similarity 71 member C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153364.3	645	Missense Mutation	ATT,GTT	I74V	NP_699195.1

View Full Product Details