Product Details

SNP ID: rs111247821
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:111514809 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATGGAAACGGGACCCAGCGAAGAA[C/G]CTAGCGGCCGAAAAGAGTCCCAGGA
Phenotype: MIM: 605673 MIM: 611374 MIM: 611375
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: BTG4 PubMed Links

Gene Details

Gene: BTG4
Gene Name: BTG anti-proliferation factor 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017589.3	25	Intron			NP_060059.1

Gene: C11orf88
Gene Name: chromosome 11 open reading frame 88

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001100388.1	25	Missense Mutation	CCT,GCT	P9A	NP_001093858.1
NM_207430.2	25	Missense Mutation	CCT,GCT	P9A	NP_997313.2

Gene: MIR34B
Gene Name: microRNA 34b

There are no transcripts associated with this gene.

Gene: MIR34C
Gene Name: microRNA 34c

There are no transcripts associated with this gene.

View Full Product Details