Product Details

SNP ID: rs112031241
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:47626160 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCCAGGTACTCCACTCTGACCAT[A/G]ATCCTTTCACTGCAATGAGGGGTAG
Phenotype: MIM: 300383 MIM: 311040 MIM: 313440
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CFP PubMed Links

Gene Details

Gene: CFP
Gene Name: complement factor properdin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145252.1	1268	Missense Mutation	TCA,TTA	S381L	NP_001138724.1
NM_002621.2	1268	Missense Mutation	TCA,TTA	S381L	NP_002612.1
XM_017029575.1	1268	Missense Mutation	TCA,TTA	S246L	XP_016885064.1

Gene: ELK1
Gene Name: ELK1, ETS transcription factor

There are no transcripts associated with this gene.

Gene: SYN1
Gene Name: synapsin I

There are no transcripts associated with this gene.

View Full Product Details