Product Details

SNP ID: rs113590688
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:103389168 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGAACCGTAGACAGTTTAAAATCC[A/T]ATAAACAAAGCAAACAGTTTAGATA
Phenotype: MIM: 612333 MIM: 601787 MIM: 615204
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: MIR1307 PubMed Links

Gene Details

Gene: MIR1307
Gene Name: microRNA 1307

There are no transcripts associated with this gene.

Gene: PDCD11
Gene Name: programmed cell death 11

There are no transcripts associated with this gene.

Gene: TAF5
Gene Name: TATA-box binding protein associated factor 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006951.4		Intron			NP_008882.2
NM_139052.2		Intron			NP_620640.1

Gene: USMG5
Gene Name: up-regulated during skeletal muscle growth 5 homolog (mouse)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001206426.1		Intron			NP_001193355.1
NM_001206427.1		Intron			NP_001193356.1
NM_032747.3		Intron			NP_116136.1

View Full Product Details