Product Details

SNP ID
rs138637203
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.10:13439178 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
ATAAATAAGCAAGATAATTTCAGAG[A/G]GAGAGGCAAGAGATGTGAAGGGTAA
Phenotype
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
BEND7 PubMed Links
Additional Information
For this assay, SNP(s) [rs10590401] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
BEND7
Gene Name
BEN domain containing 7
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001100912.1 1486 Intron NP_001094382.1
NM_152751.2 1486 Silent Mutation TCC,TCT S467S NP_689964.2
XM_005252402.4 1486 Silent Mutation TCC,TCT S519S XP_005252459.1
XM_011519390.2 1486 Silent Mutation TCC,TCT S480S XP_011517692.1
XM_011519391.2 1486 Silent Mutation TCC,TCT S479S XP_011517693.1
XM_011519392.2 1486 Silent Mutation TCC,TCT S518S XP_011517694.1
XM_011519393.2 1486 Silent Mutation TCC,TCT S504S XP_011517695.1
XM_011519394.2 1486 Silent Mutation TCC,TCT S480S XP_011517696.1
XM_011519395.2 1486 Silent Mutation TCC,TCT S480S XP_011517697.1
XM_011519396.2 1486 Silent Mutation TCC,TCT S480S XP_011517698.1
XM_011519397.2 1486 Silent Mutation TCC,TCT S480S XP_011517699.1
XM_011519398.2 1486 Intron XP_011517700.1
XM_011519399.2 1486 Intron XP_011517701.1
XM_011519400.2 1486 Intron XP_011517702.1
XM_011519401.2 1486 Intron XP_011517703.1
XM_011519402.2 1486 Intron XP_011517704.1
XM_011519403.2 1486 Intron XP_011517705.1
XM_011519404.2 1486 Intron XP_011517706.1
XM_011519405.2 1486 Intron XP_011517707.1
XM_011519406.2 1486 Intron XP_011517708.1
XM_011519407.1 1486 Intron XP_011517709.1
XM_011519408.2 1486 Intron XP_011517710.1
XM_011519410.2 1486 Intron XP_011517712.1
XM_011519411.2 1486 Intron XP_011517713.1
XM_011519412.1 1486 Intron XP_011517714.1
XM_011519413.1 1486 Intron XP_011517715.1
XM_011519414.1 1486 Intron XP_011517716.1
XM_017015915.1 1486 Silent Mutation TCC,TCT S480S XP_016871404.1
XM_017015916.1 1486 Intron XP_016871405.1
XM_017015917.1 1486 Intron XP_016871406.1
XM_017015918.1 1486 Intron XP_016871407.1
XM_017015919.1 1486 Intron XP_016871408.1

View Full Product Details