Product Details

SNP ID

rs141218257

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.10:68343859 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GCAAGTCAGTCAGTGTTGATACATG[A/G]GTTTTGAAAAGTGAGAAACTTACTT

Phenotype

MIM: 602324 MIM: 610328

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

HNRNPH3 PubMed Links

Additional Information

For this assay, SNP(s) [rs146249363] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

HNRNPH3

Gene Name

heterogeneous nuclear ribonucleoprotein H3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001322434.1	3994	Intron			NP_001309363.1
NM_001322436.1	3994	Intron			NP_001309365.1
NM_001322437.1	3994	Intron			NP_001309366.1
NM_001322438.1	3994	Intron			NP_001309367.1
NM_001322439.1	3994	Intron			NP_001309368.1
NM_001322440.1	3994	Intron			NP_001309369.1
NM_001322441.1	3994	Intron			NP_001309370.1
NM_001322442.1	3994	Intron			NP_001309371.1
NM_001322443.1	3994	Intron			NP_001309372.1
NM_001322444.1	3994	Intron			NP_001309373.1
NM_001322445.1	3994	Intron			NP_001309374.1
NM_001322446.1	3994	Intron			NP_001309375.1
NM_001322447.1	3994	Intron			NP_001309376.1
NM_001322448.1	3994	Intron			NP_001309377.1
NM_001322449.1	3994	Intron			NP_001309378.1
NM_001322450.1	3994	Intron			NP_001309379.1
NM_001322451.1	3994	Intron			NP_001309380.1
NM_001322452.1	3994	Intron			NP_001309381.1
NM_001322453.1	3994	Intron			NP_001309382.1
NM_012207.2	3994	Intron			NP_036339.1
NM_021644.3	3994	Intron			NP_067676.2
XM_011539742.1	3994	Intron			XP_011538044.1
XM_017016168.1	3994	Intron			XP_016871657.1
XM_017016169.1	3994	Intron			XP_016871658.1

Gene

RUFY2

Gene Name

RUN and FYVE domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042417.1	3994	Intron			NP_001035882.1
NM_001278225.1	3994	Intron			NP_001265154.1
NM_017987.4	3994	UTR 3			NP_060457.4
XM_005269953.4	3994	UTR 3			XP_005270010.1
XM_005269955.4	3994	UTR 3			XP_005270012.1
XM_005269956.4	3994	UTR 3			XP_005270013.1
XM_005269957.4	3994	UTR 3			XP_005270014.1
XM_006717911.3	3994	Intron			XP_006717974.1
XM_011539942.2	3994	UTR 3			XP_011538244.1

View Full Product Details