Product Details

SNP ID: rs145068570
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:100988451 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGATGGTCACAGTTGCCTGCGGGCA[C/G]TGAGCCCCTTTGCAGAGTCTTCACA
Phenotype: MIM: 606075 MIM: 610454 MIM: 611848
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: C10orf2 PubMed Links

Gene Details

Gene: C10orf2
Gene Name: chromosome 10 open reading frame 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163812.1	415	Missense Mutation	CTG,GTG	L81V	NP_001157284.1
NM_001163813.1	415	Intron			NP_001157285.1
NM_001163814.1	415	Intron			NP_001157286.1
NM_021830.4	415	Missense Mutation	CTG,GTG	L81V	NP_068602.2
XM_011539975.2	415	Intron			XP_011538277.1
XM_017016437.1	415	UTR 5			XP_016871926.1

Gene: LZTS2
Gene Name: leucine zipper tumor suppressor 2

There are no transcripts associated with this gene.

Gene: MRPL43
Gene Name: mitochondrial ribosomal protein L43

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308396.1	415	Intron			NP_001295325.1
NM_032112.2	415	Intron			NP_115488.2
NM_176792.2	415	Intron			NP_789762.1
NM_176793.1	415	Intron			NP_789763.1
NM_176794.1	415	Intron			NP_789764.1
XM_005270231.2	415	Intron			XP_005270288.1
XM_006718035.3	415	Intron			XP_006718098.1
XM_017016790.1	415	Intron			XP_016872279.1

Gene: SEMA4G
Gene Name: semaphorin 4G

There are no transcripts associated with this gene.

View Full Product Details