Product Details

SNP ID

rs151237508

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.10:68341309 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CATGTCTAAAGATAAAAATAACATG[C/T]GTAAGTGGTGTCTTTGGCACACAAT

Phenotype

MIM: 602324 MIM: 612189 MIM: 610328

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

HNRNPH3 PubMed Links

Gene Details

Gene

HNRNPH3

Gene Name

heterogeneous nuclear ribonucleoprotein H3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001322434.1	986	Nonsense Mutation	CAA,TAA	Q259*	NP_001309363.1
NM_001322436.1	986	Nonsense Mutation	CAA,TAA	Q259*	NP_001309365.1
NM_001322437.1	986	Nonsense Mutation	CAA,TAA	Q259*	NP_001309366.1
NM_001322438.1	986	Nonsense Mutation	CAA,TAA	Q244*	NP_001309367.1
NM_001322439.1	986	Nonsense Mutation	CAA,TAA	Q244*	NP_001309368.1
NM_001322440.1	986	Nonsense Mutation	CAA,TAA	Q244*	NP_001309369.1
NM_001322441.1	986	Nonsense Mutation	CAA,TAA	Q244*	NP_001309370.1
NM_001322442.1	986	Nonsense Mutation	CAA,TAA	Q253*	NP_001309371.1
NM_001322443.1	986	Nonsense Mutation	CAA,TAA	Q253*	NP_001309372.1
NM_001322444.1	986	Nonsense Mutation	CAA,TAA	Q151*	NP_001309373.1
NM_001322445.1	986	Nonsense Mutation	CAA,TAA	Q128*	NP_001309374.1
NM_001322446.1	986	Nonsense Mutation	CAA,TAA	Q128*	NP_001309375.1
NM_001322447.1	986	Nonsense Mutation	CAA,TAA	Q128*	NP_001309376.1
NM_001322448.1	986	Nonsense Mutation	CAA,TAA	Q128*	NP_001309377.1
NM_001322449.1	986	Nonsense Mutation	CAA,TAA	Q128*	NP_001309378.1
NM_001322450.1	986	Nonsense Mutation	CAA,TAA	Q122*	NP_001309379.1
NM_001322451.1	986	Nonsense Mutation	CAA,TAA	Q90*	NP_001309380.1
NM_001322452.1	986	Nonsense Mutation	CAA,TAA	Q90*	NP_001309381.1
NM_001322453.1	986	Nonsense Mutation	CAA,TAA	Q90*	NP_001309382.1
NM_012207.2	986	Nonsense Mutation	CAA,TAA	Q259*	NP_036339.1
NM_021644.3	986	Nonsense Mutation	CAA,TAA	Q244*	NP_067676.2
XM_011539742.1	986	Nonsense Mutation	CAA,TAA	Q151*	XP_011538044.1
XM_017016168.1	986	Nonsense Mutation	CAA,TAA	Q259*	XP_016871657.1
XM_017016169.1	986	Nonsense Mutation	CAA,TAA	Q128*	XP_016871658.1

Gene

PBLD

Gene Name

phenazine biosynthesis like protein domain containing

There are no transcripts associated with this gene.

Gene

RUFY2

Gene Name

RUN and FYVE domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042417.1	986	Intron			NP_001035882.1
NM_001278225.1	986	Intron			NP_001265154.1
NM_017987.4	986	Intron			NP_060457.4
XM_005269953.4	986	Intron			XP_005270010.1
XM_005269955.4	986	Intron			XP_005270012.1
XM_005269956.4	986	Intron			XP_005270013.1
XM_005269957.4	986	Intron			XP_005270014.1
XM_006717911.3	986	Intron			XP_006717974.1
XM_011539942.2	986	Intron			XP_011538244.1

View Full Product Details