Product Details
- SNP ID
-
rs139252368
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:4907833 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATTTTAGCCATTAGGAGCATTCTCT[C/T]AGTGATTCCATTTCCCTTCACCTTA
- Phenotype
-
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
OR51A7
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs10500627] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR51A7
- Gene Name
- olfactory receptor family 51 subfamily A member 7
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001004749.1 |
464 |
Missense Mutation |
TCA,TTA |
S155L |
NP_001004749.1 |
- Gene
- OR51G2
- Gene Name
- olfactory receptor family 51 subfamily G member 2
There are no transcripts associated with this gene.
View Full Product Details