Product Details

SNP ID: rs139252433
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:125894119 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCTATTCCACAGGGTACTGGAACA[C/G]TGTCCAGTCCTTGTAGCATACTATA
Phenotype: MIM: 607663 MIM: 610693 MIM: 616283
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DDX25 PubMed Links

Gene Details

Gene: DDX25
Gene Name: DEAD-box helicase 25

There are no transcripts associated with this gene.

Gene: HYLS1
Gene Name: HYLS1, centriolar and ciliogenesis associated

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134793.1	1210	Intron			NP_001128265.1
NM_145014.2	1210	Intron			NP_659451.1
XM_005271430.2	1210	Intron			XP_005271487.1
XM_006718777.3	1210	Intron			XP_006718840.1
XM_011542659.2	1210	Intron			XP_011540961.1
XM_017017320.1	1210	Intron			XP_016872809.1
XM_017017321.1	1210	Intron			XP_016872810.1

Gene: PUS3
Gene Name: pseudouridylate synthase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271985.1	1210	Missense Mutation	ACT,AGT	T163S	NP_001258914.1
NM_031307.3	1210	Missense Mutation	ACT,AGT	T371S	NP_112597.3
XM_005271687.3	1210	Missense Mutation	ACT,AGT	T272S	XP_005271744.1
XM_005271688.3	1210	UTR 3			XP_005271745.1

View Full Product Details