Product Details
- SNP ID
-
rs140556162
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:65855994 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CCTTGGTCTCATAGGTTGCATCATA[A/G]AGGGCATAGCGGCAGTCCTTATCTG
- Phenotype
-
MIM: 601442
MIM: 606591
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
CFL1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs652021] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- CFL1
- Gene Name
- cofilin 1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_005507.2 |
486 |
Silent Mutation |
CTC,CTT |
L84L |
NP_005498.1 |
- Gene
- MUS81
- Gene Name
- MUS81 structure-specific endonuclease subunit
There are no transcripts associated with this gene.
- Gene
- SNX32
- Gene Name
- sorting nexin 32
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_152760.2 |
486 |
Intron |
|
|
NP_689973.2 |
View Full Product Details