Product Details

SNP ID: rs142245358
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:72099214 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGGCTCCATTGAGAGCTTTGGTAG[G/T]GGGGCTGCTAGGGTCCAGCAGCAGC
Phenotype: MIM: 614717 MIM: 613510 MIM: 612414
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ANAPC15 PubMed Links

Gene Details

Gene: ANAPC15
Gene Name: anaphase promoting complex subunit 15

There are no transcripts associated with this gene.

Gene: LAMTOR1
Gene Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017907.2	248	Missense Mutation			NP_060377.1

Gene: LRTOMT
Gene Name: leucine rich transmembrane and O-methyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145307.4	248	Intron			NP_001138779.1
NM_001145308.4	248	Intron			NP_001138780.1
NM_001145309.3	248	Intron			NP_001138781.1
NM_001145310.3	248	Intron			NP_001138782.1
NM_001205138.3	248	Intron			NP_001192067.1
NM_001271471.2	248	Intron			NP_001258400.1
NM_001318803.1	248	Intron			NP_001305732.1
NM_145309.5	248	Intron			NP_660352.1
XM_006718473.3	248	Intron			XP_006718536.1
XM_006718474.3	248	Intron			XP_006718537.1
XM_011544847.2	248	Intron			XP_011543149.1
XM_011544848.2	248	Intron			XP_011543150.1
XM_017017356.1	248	Intron			XP_016872845.1
XM_017017357.1	248	Intron			XP_016872846.1
XM_017017358.1	248	Intron			XP_016872847.1
XM_017017359.1	248	Intron			XP_016872848.1
XM_017017360.1	248	Intron			XP_016872849.1

View Full Product Details