Product Details

SNP ID: rs143154193
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64361476 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GACCTCTTGCCCTCCCAGAAAGAGC[A/G]GACCTTCTCCTTCTGTGGCACCATC
Phenotype: MIM: 611205 MIM: 603606
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CCDC88B PubMed Links

Gene Details

Gene: CCDC88B
Gene Name: coiled-coil domain containing 88B

There are no transcripts associated with this gene.

Gene: MIR1237
Gene Name: microRNA 1237

There are no transcripts associated with this gene.

Gene: RPS6KA4
Gene Name: ribosomal protein S6 kinase A4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001006944.1	641	Missense Mutation	CAG,CGG	Q193R	NP_001006945.1
NM_001300802.1	641	Missense Mutation	CAG,CGG	Q193R	NP_001287731.1
NM_001318361.1	641	Missense Mutation	CAG,CGG	Q130R	NP_001305290.1
NM_003942.2	641	Missense Mutation	CAG,CGG	Q193R	NP_003933.1
XM_005274380.1	641	Missense Mutation	CAG,CGG	Q193R	XP_005274437.1
XM_017018527.1	641	UTR 5			XP_016874016.1

View Full Product Details