Product Details

SNP ID

rs143481066

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.11:47273892 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGCTTGGTGCCCTGATGCTTCTCTG[A/T]GATAAACTGATGAATTGGAACCATG

Phenotype

MIM: 603584 MIM: 602423

Polymorphism

A/T, Transversion substitution

Allele Nomenclature

Literature Links

LOC101928943 PubMed Links

Gene Details

Gene

LOC101928943

Gene Name

uncharacterized LOC101928943

There are no transcripts associated with this gene.

Gene

MADD

Gene Name

MAP kinase activating death domain

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135943.1	193	UTR 5			NP_001129415.1
NM_001135944.1	193	UTR 5			NP_001129416.1
NM_003682.3	193	UTR 5			NP_003673.3
NM_130470.2	193	UTR 5			NP_569826.2
NM_130471.2	193	UTR 5			NP_569827.2
NM_130472.2	193	UTR 5			NP_569828.2
NM_130473.2	193	UTR 5			NP_569829.2
NM_130474.2	193	UTR 5			NP_569830.2
NM_130475.2	193	UTR 5			NP_569831.1
NM_130476.2	193	UTR 5			NP_569832.2
XM_005253189.2	193	UTR 5			XP_005253246.1
XM_005253196.2	193	UTR 5			XP_005253253.1
XM_005253199.2	193	UTR 5			XP_005253256.1
XM_005253200.2	193	UTR 5			XP_005253257.1
XM_005253201.2	193	UTR 5			XP_005253258.1
XM_005253203.2	193	UTR 5			XP_005253260.1
XM_005253204.2	193	UTR 5			XP_005253261.1
XM_005253205.1	193	UTR 5			XP_005253262.1
XM_017018478.1	193	UTR 5			XP_016873967.1
XM_017018479.1	193	UTR 5			XP_016873968.1
XM_017018480.1	193	UTR 5			XP_016873969.1
XM_017018481.1	193	UTR 5			XP_016873970.1
XM_017018482.1	193	UTR 5			XP_016873971.1
XM_017018483.1	193	UTR 5			XP_016873972.1
XM_017018484.1	193	UTR 5			XP_016873973.1
XM_017018485.1	193	UTR 5			XP_016873974.1
XM_017018486.1	193	UTR 5			XP_016873975.1
XM_017018487.1	193	UTR 5			XP_016873976.1
XM_017018488.1	193	UTR 5			XP_016873977.1
XM_017018489.1	193	UTR 5			XP_016873978.1
XM_017018490.1	193	UTR 5			XP_016873979.1
XM_017018491.1	193	UTR 5			XP_016873980.1
XM_017018492.1	193	UTR 5			XP_016873981.1
XM_017018493.1	193	UTR 5			XP_016873982.1
XM_017018494.1	193	UTR 5			XP_016873983.1
XM_017018495.1	193	UTR 5			XP_016873984.1
XM_017018496.1	193	UTR 5			XP_016873985.1
XM_017018497.1	193	UTR 5			XP_016873986.1
XM_017018498.1	193	UTR 5			XP_016873987.1
XM_017018499.1	193	UTR 5			XP_016873988.1
XM_017018500.1	193	UTR 5			XP_016873989.1
XM_017018501.1	193	UTR 5			XP_016873990.1
XM_017018502.1	193	UTR 5			XP_016873991.1
XM_017018503.1	193	UTR 5			XP_016873992.1
XM_017018504.1	193	UTR 5			XP_016873993.1
XM_017018505.1	193	UTR 5			XP_016873994.1
XM_017018506.1	193	UTR 5			XP_016873995.1
XM_017018507.1	193	UTR 5			XP_016873996.1
XM_017018508.1	193	UTR 5			XP_016873997.1
XM_017018509.1	193	UTR 5			XP_016873998.1
XM_017018510.1	193	UTR 5			XP_016873999.1

Gene

NR1H3

Gene Name

nuclear receptor subfamily 1 group H member 3

There are no transcripts associated with this gene.

View Full Product Details