Product Details

SNP ID: rs144434621
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65573521 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTCCTACCCACCGGATGCGGGCCT[A/G]TCTGACGACGAGGAGCCTCCCGATG
Phenotype: MIM: 616128 MIM: 606044
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EHBP1L1 PubMed Links

Gene Details

Gene: EHBP1L1
Gene Name: EH domain binding protein 1 like 1

There are no transcripts associated with this gene.

Gene: FAM89B
Gene Name: family with sequence similarity 89 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098784.1	771	Missense Mutation	ATC,GTC	I154V	NP_001092254.1
NM_001098785.1	771	Silent Mutation	CTA,CTG	L150L	NP_001092255.1
NM_152832.2	771	Silent Mutation	CTA,CTG	L137L	NP_690045.1

Gene: SSSCA1
Gene Name: Sjogren syndrome/scleroderma autoantigen 1

There are no transcripts associated with this gene.

Gene: SSSCA1-AS1
Gene Name: SSSCA1 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

View Full Product Details