Product Details

SNP ID: rs146339793
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67399012 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCCACCACCTCGGCTCCAAAGGT[A/G]AAAGAGACGCCACGGTCGTTCTCGC
Phenotype: MIM: 176875 MIM: 603761 MIM: 610831
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC100130987 PubMed Links

Gene Details

Gene: LOC100130987
Gene Name: uncharacterized LOC100130987

There are no transcripts associated with this gene.

Gene: PPP1CA
Gene Name: protein phosphatase 1 catalytic subunit alpha

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008709.1	831	Silent Mutation	TTC,TTT	F236F	NP_001008709.1
NM_002708.3	831	Silent Mutation	TTC,TTT	F225F	NP_002699.1
NM_206873.1	831	Silent Mutation	TTC,TTT	F181F	NP_996756.1

Gene: RAD9A
Gene Name: RAD9 checkpoint clamp component A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243224.1	831	Intron			NP_001230153.1
NM_004584.2	831	Intron			NP_004575.1
XM_006718652.3	831	Intron			XP_006718715.1
XM_017018097.1	831	Intron			XP_016873586.1
XM_017018098.1	831	Intron			XP_016873587.1

Gene: TBC1D10C
Gene Name: TBC1 domain family member 10C

There are no transcripts associated with this gene.

View Full Product Details