Product Details
- SNP ID
-
rs147171533
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:6795023 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGCAGCCGAAGGAATGTGCATCACA[C/G]CACCAGTAATGGCCACATAGGAGGC
- Phenotype
-
MIM: 608495
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
OR2AG1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs71946386] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR2AG1
- Gene Name
- olfactory receptor family 2 subfamily AG member 1 (gene/pseudogene)
There are no transcripts associated with this gene.
- Gene
- OR6A2
- Gene Name
- olfactory receptor family 6 subfamily A member 2
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_003696.2 |
886 |
Missense Mutation |
GCT,GGT |
A229G |
NP_003687.2 |
View Full Product Details