Product Details

SNP ID

rs147594350

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.11:72110179 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTCATCATCCTCTGAGTCCTCTTCA[C/G]TATCCTCATCATCTTCATCATCCTC

Phenotype

MIM: 614717 MIM: 613510 MIM: 612414

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

ANAPC15 PubMed Links

Additional Information

For this assay, SNP(s) [rs17161980] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

ANAPC15

Gene Name

anaphase promoting complex subunit 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278485.1	360	Intron			NP_001265414.1
NM_001278486.1	360	Intron			NP_001265415.1
NM_001278487.1	360	Intron			NP_001265416.1
NM_001278488.1	360	Missense Mutation	ACT,AGT	T76S	NP_001265417.1
NM_001278489.1	360	Intron			NP_001265418.1
NM_001278490.1	360	Intron			NP_001265419.1
NM_001278491.1	360	Missense Mutation	ACT,AGT	T76S	NP_001265420.1
NM_001278492.1	360	Missense Mutation	ACT,AGT	T76S	NP_001265421.1
NM_001278493.1	360	Missense Mutation	ACT,AGT	T76S	NP_001265422.1
NM_001278494.1	360	Missense Mutation	ACT,AGT	T76S	NP_001265423.1
NM_014042.2	360	Intron			NP_054761.1
XM_017017488.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872977.1
XM_017017489.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872978.1
XM_017017490.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872979.1
XM_017017491.1	360	Intron			XP_016872980.1
XM_017017492.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872981.1
XM_017017493.1	360	Intron			XP_016872982.1
XM_017017494.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872983.1
XM_017017495.1	360	Missense Mutation	ACT,AGT	T67S	XP_016872984.1
XM_017017496.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872985.1
XM_017017497.1	360	Missense Mutation	ACT,AGT	T76S	XP_016872986.1

Gene

LAMTOR1

Gene Name

late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

There are no transcripts associated with this gene.

Gene

LRTOMT

Gene Name

leucine rich transmembrane and O-methyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145307.4	360	Intron			NP_001138779.1
NM_001145308.4	360	UTR 3			NP_001138780.1
NM_001145309.3	360	UTR 3			NP_001138781.1
NM_001145310.3	360	UTR 3			NP_001138782.1
NM_001205138.3	360	Intron			NP_001192067.1
NM_001271471.2	360	Intron			NP_001258400.1
NM_001318803.1	360	Intron			NP_001305732.1
NM_145309.5	360	Intron			NP_660352.1
XM_006718473.3	360	Intron			XP_006718536.1
XM_006718474.3	360	Intron			XP_006718537.1
XM_011544847.2	360	Intron			XP_011543149.1
XM_011544848.2	360	Intron			XP_011543150.1
XM_017017356.1	360	Intron			XP_016872845.1
XM_017017357.1	360	Intron			XP_016872846.1
XM_017017358.1	360	Intron			XP_016872847.1
XM_017017359.1	360	Intron			XP_016872848.1
XM_017017360.1	360	Intron			XP_016872849.1

View Full Product Details