Product Details
- SNP ID
-
rs147741332
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:57387817 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CAGGGCTGGTGAGCAGCCCAGTATG[C/T]AAAGTTCCAGCGGCTGCCGTCAACC
- Phenotype
-
MIM: 605601
MIM: 606814
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PRG2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs630396] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PRG2
- Gene Name
- proteoglycan 2, pro eosinophil major basic protein
- Gene
- PRG3
- Gene Name
- proteoglycan 3, pro eosinophil major basic protein 2
There are no transcripts associated with this gene.
View Full Product Details