Product Details

SNP ID: rs149689390
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:66482234 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACCCAGTACATCCTGCCCAATGAC[A/G]TCGGCGTGTCTAGCCTGGACTGCCG
Phenotype: MIM: 606818 MIM: 609827
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DPP3 PubMed Links

Gene Details

Gene: DPP3
Gene Name: dipeptidyl peptidase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256670.1	495	Missense Mutation	ATC,GTC	I12V	NP_001243599.1
NM_005700.4	495	Missense Mutation	ATC,GTC	I12V	NP_005691.2
NM_130443.3	495	Missense Mutation	ATC,GTC	I12V	NP_569710.2

Gene: LOC101928069
Gene Name: uncharacterized LOC101928069

There are no transcripts associated with this gene.

Gene: PELI3
Gene Name: pellino E3 ubiquitin protein ligase family member 3

There are no transcripts associated with this gene.

View Full Product Details