Product Details

SNP ID: rs138812548
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:55716165 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTCCCGCCTCCTAAAAGAACACCA[A/G]GCCAAGCAGAATGAACGCAAGGAGC
Phenotype: MIM: 601444 MIM: 155740 MIM: 600536 MIM: 601617
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BLOC1S1 PubMed Links

Gene Details

Gene: BLOC1S1
Gene Name: biogenesis of lysosomal organelles complex 1 subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001487.3	132	Silent Mutation	CAA,CAG	Q38Q	NP_001478.2

Gene: BLOC1S1-RDH5
Gene Name: BLOC1S1-RDH5 readthrough

There are no transcripts associated with this gene.

Gene: CD63
Gene Name: CD63 molecule

There are no transcripts associated with this gene.

Gene: ITGA7
Gene Name: integrin subunit alpha 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144996.1	132	Intron			NP_001138468.1
NM_001144997.1	132	Intron			NP_001138469.1
NM_002206.2	132	Intron			NP_002197.2
XM_005268839.1	132	Intron			XP_005268896.1
XM_005268840.1	132	Intron			XP_005268897.1
XM_005268841.1	132	Intron			XP_005268898.1
XM_005268842.1	132	Intron			XP_005268899.1
XM_005268844.1	132	Intron			XP_005268901.1
XM_005268846.1	132	Intron			XP_005268903.1
XM_005268848.1	132	Intron			XP_005268905.1
XM_005268849.1	132	Intron			XP_005268906.1
XM_005268850.1	132	Intron			XP_005268907.1
XM_017019265.1	132	Intron			XP_016874754.1

Gene: RDH5
Gene Name: retinol dehydrogenase 5

There are no transcripts associated with this gene.

View Full Product Details