Product Details

SNP ID: rs140194153
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57769090 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTGGGAAATTCTTCCCTCCATTA[C/T]GTAGAACTTTCTTCCCCTCCTCAGT
Phenotype: MIM: 609506 MIM: 613336 MIM: 604466 MIM: 615258
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYP27B1 PubMed Links

Gene Details

Gene: CYP27B1
Gene Name: cytochrome P450 family 27 subfamily B member 1

There are no transcripts associated with this gene.

Gene: MARCH9
Gene Name: membrane associated ring-CH-type finger 9

There are no transcripts associated with this gene.

Gene: METTL1
Gene Name: methyltransferase like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005371.5	785	Missense Mutation			NP_005362.3
NM_023033.3	785	UTR 3			NP_075422.3
XM_005268873.2	785	Missense Mutation			XP_005268930.1
XM_017019305.1	785	Intron			XP_016874794.1

Gene: METTL21B
Gene Name: methyltransferase like 21B

There are no transcripts associated with this gene.

View Full Product Details