Product Details

SNP ID: rs140931660
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:48770784 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTTACCAATCTTCATCTGGAAAT[A/T]GTTGAAGGAGTGCTCATTGATGTGC
Phenotype: MIM: 600294
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: ADCY6 PubMed Links

Gene Details

Gene: ADCY6
Gene Name: adenylate cyclase 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015270.4	3595	Missense Mutation	AAT,TAT	N1080Y	NP_056085.1
XM_006719210.3	3595	Missense Mutation	AAT,TAT	N1080Y	XP_006719273.1
XM_017018743.1	3595	Missense Mutation	AAT,TAT	N979Y	XP_016874232.1

Gene: LINC00935
Gene Name: long intergenic non-protein coding RNA 935

There are no transcripts associated with this gene.

Gene: MIR4701
Gene Name: microRNA 4701

There are no transcripts associated with this gene.

View Full Product Details