Product Details

SNP ID: rs141173025
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:50120165 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGAGTCTACCACTATTTCCAGTGGC[A/G]CAGGGCCCAGCGCCAGGCCGCAGAA
Phenotype: MIM: 615335 MIM: 614478 MIM: 138420
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CERS5 PubMed Links

Gene Details

Gene: CERS5
Gene Name: ceramide synthase 5

There are no transcripts associated with this gene.

Gene: COX14
Gene Name: COX14, cytochrome c oxidase assembly factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001257133.1	511	Missense Mutation	CAC,CGC	H41R	NP_001244062.1
NM_001257134.1	511	Missense Mutation	CAC,CGC	H41R	NP_001244063.1
NM_032901.3	511	Missense Mutation	CAC,CGC	H41R	NP_116290.1

Gene: GPD1
Gene Name: glycerol-3-phosphate dehydrogenase 1

There are no transcripts associated with this gene.

View Full Product Details