Product Details

SNP ID: rs141496776
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57773033 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCCGTAGGCCCTGAGCCTGTGCA[A/G]TTATTTCGAGAGTCAAAATGTGGAT
Phenotype: MIM: 609506 MIM: 604466 MIM: 615258 MIM: 604723
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CYP27B1 PubMed Links

Gene Details

Gene: CYP27B1
Gene Name: cytochrome P450 family 27 subfamily B member 1

There are no transcripts associated with this gene.

Gene: METTL1
Gene Name: methyltransferase like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005371.5	319	Intron			NP_005362.3
NM_023033.3	319	Intron			NP_075422.3
XM_005268873.2	319	Intron			XP_005268930.1
XM_017019305.1	319	Intron			XP_016874794.1

Gene: METTL21B
Gene Name: methyltransferase like 21B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015433.2	319	Missense Mutation	AAT,AGT	N65S	NP_056248.2
NM_206914.1	319	Missense Mutation	AAT,AGT	N65S	NP_996797.1

Gene: TSFM
Gene Name: Ts translation elongation factor, mitochondrial

There are no transcripts associated with this gene.

View Full Product Details