Product Details

SNP ID: rs142007324
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57524978 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTTTTCAACTTTGACCCTTTGGCCC[C/T]GGTGACCCCGGGTGGGGCTGGGGTG
Phenotype: MIM: 607376 MIM: 126337 MIM: 156560 MIM: 614489
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DCTN2 PubMed Links

Gene Details

Gene: DCTN2
Gene Name: dynactin subunit 2

There are no transcripts associated with this gene.

Gene: DDIT3
Gene Name: DNA damage inducible transcript 3

There are no transcripts associated with this gene.

Gene: MARS
Gene Name: methionyl-tRNA synthetase

There are no transcripts associated with this gene.

Gene: MBD6
Gene Name: methyl-CpG binding domain protein 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052897.3	519	Missense Mutation	CCG,CTG	P81L	NP_443129.3
XM_005268617.1	519	Missense Mutation	CCG,CTG	P81L	XP_005268674.1
XM_005268618.1	519	Missense Mutation	CCG,CTG	P81L	XP_005268675.1
XM_005268620.2	519	Missense Mutation	CCG,CTG	P81L	XP_005268677.1
XM_006719217.1	519	Missense Mutation	CCG,CTG	P81L	XP_006719280.1
XM_006719218.1	519	Missense Mutation	CCG,CTG	P81L	XP_006719281.1
XM_011537851.2	519	Missense Mutation	CCG,CTG	P81L	XP_011536153.1

Gene: MIR616
Gene Name: microRNA 616

There are no transcripts associated with this gene.

View Full Product Details