Product Details

SNP ID: rs144342814
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6845797 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTGGGACTCCATGAAGTCTGAGC[A/G]TGTGGGTAAGGGCCAGCCCTGGCTG
Phenotype: MIM: 607749 MIM: 139130 MIM: 610342 MIM: 601447
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CDCA3 PubMed Links

Gene Details

Gene: CDCA3
Gene Name: cell division cycle associated 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297602.1	1121	Intron			NP_001284531.1
NM_001297603.1	1121	Intron			NP_001284532.1
NM_001297604.1	1121	Intron			NP_001284533.1
NM_031299.5	1121	Intron			NP_112589.1

Gene: GNB3
Gene Name: G protein subunit beta 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297571.1	1121	Missense Mutation	CAT,CGT	H303R	NP_001284500.1
NM_002075.3	1121	Missense Mutation	CAT,CGT	H304R	NP_002066.1
XM_011520953.2	1121	Missense Mutation	CAT,CGT	H304R	XP_011519255.1

Gene: P3H3
Gene Name: prolyl 3-hydroxylase 3

There are no transcripts associated with this gene.

Gene: USP5
Gene Name: ubiquitin specific peptidase 5

There are no transcripts associated with this gene.

View Full Product Details