Product Details

SNP ID: rs148441655
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:113187003 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGAGCTGTGAGACCACCCCCTCAA[A/G]GGGCAGCACCCCCACCCTCACACCA
Phenotype: MIM: 611665
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DDX54 PubMed Links

Gene Details

Gene: DDX54
Gene Name: DEAD-box helicase 54

There are no transcripts associated with this gene.

Gene: IQCD
Gene Name: IQ motif containing D

There are no transcripts associated with this gene.

Gene: RITA1
Gene Name: RBPJ interacting and tubulin associated 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286215.1	921	Missense Mutation	AAG,AGG	K110R	NP_001273144.1
NM_032848.2	921	Missense Mutation	AAG,AGG	K86R	NP_116237.1
XM_005253972.2	921	Missense Mutation	AAG,AGG	K86R	XP_005254029.1

View Full Product Details