Product Details

SNP ID: rs149430986
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57244364 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATCAATGACTGTGATCTTCTCTCCT[A/G]GCCTGGGAGGGGAAGGGAGGGGCCT
Phenotype: MIM: 138450 MIM: 615521
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: NDUFA4L2 PubMed Links

Gene Details

Gene: NDUFA4L2
Gene Name: NDUFA4, mitochondrial complex associated like 2

There are no transcripts associated with this gene.

Gene: R3HDM2
Gene Name: R3H domain containing 2

There are no transcripts associated with this gene.

Gene: SHMT2
Gene Name: serine hydroxymethyltransferase 2

There are no transcripts associated with this gene.

Gene: STAC3
Gene Name: SH3 and cysteine rich domain 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286256.1	1099	Missense Mutation	CCA,CTA	P231L	NP_001273185.1
NM_001286257.1	1099	Missense Mutation	CCA,CTA	P84L	NP_001273186.1
NM_145064.2	1099	Missense Mutation	CCA,CTA	P270L	NP_659501.1
XM_011538126.2	1099	Missense Mutation	CCA,CTA	P270L	XP_011536428.1

View Full Product Details