Product Details
- SNP ID
-
rs151073656
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.13:94711739 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CTTGAGCGCAGGGTGCTCGGCGTCC[A/G]CCACGCCGCCCAGGCCGTAGGGCAC
- Phenotype
-
MIM: 604974
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC101927248
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs1060474] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC101927248
- Gene Name
- uncharacterized LOC101927248
There are no transcripts associated with this gene.
- Gene
- SOX21
- Gene Name
- SRY-box 21
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_007084.3 |
805 |
Missense Mutation |
GCG,GTG |
A104V |
NP_009015.1 |
- Gene
- SOX21-AS1
- Gene Name
- SOX21 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.
View Full Product Details