Product Details

SNP ID
rs137962022
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.14:21030712 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GACTGTGGCATCATGGATGGCAAGA[C/G]AGTCACCTCCACGGACGTGGACATC
Phenotype
MIM: 605272 MIM: 616956
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
MIR6717 PubMed Links

Gene Details

Gene
MIR6717
Gene Name
microRNA 6717
There are no transcripts associated with this gene.

Gene
NDRG2
Gene Name
NDRG family member 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001282211.1 255 Intron NP_001269140.1
NM_001282212.1 255 Intron NP_001269141.1
NM_001282213.1 255 Intron NP_001269142.1
NM_001282214.1 255 Intron NP_001269143.1
NM_001282215.1 255 Intron NP_001269144.1
NM_001282216.1 255 Intron NP_001269145.1
NM_001320329.1 255 Intron NP_001307258.1
NM_016250.2 255 Intron NP_057334.1
NM_201535.1 255 Intron NP_963293.1
NM_201536.1 255 Intron NP_963294.1
NM_201537.1 255 Intron NP_963831.1
NM_201538.1 255 Intron NP_963832.1
NM_201539.1 255 Intron NP_963833.1
NM_201540.1 255 Intron NP_963834.1
NM_201541.1 255 Intron NP_963835.1
XM_011536996.2 255 Intron XP_011535298.1
XM_011536997.1 255 Intron XP_011535299.1
XM_011536998.1 255 Intron XP_011535300.1
XM_011536999.1 255 Intron XP_011535301.1
XM_011537001.1 255 Intron XP_011535303.1
XM_011537002.1 255 Intron XP_011535304.1
XM_017021480.1 255 Intron XP_016876969.1
XM_017021481.1 255 Intron XP_016876970.1
XM_017021482.1 255 Intron XP_016876971.1
XM_017021483.1 255 Intron XP_016876972.1
XM_017021484.1 255 Intron XP_016876973.1
XM_017021485.1 255 Intron XP_016876974.1
XM_017021486.1 255 Intron XP_016876975.1
XM_017021487.1 255 Intron XP_016876976.1
XM_017021488.1 255 Intron XP_016876977.1
XM_017021489.1 255 Intron XP_016876978.1
XM_017021490.1 255 Intron XP_016876979.1
XM_017021491.1 255 Intron XP_016876980.1
XM_017021492.1 255 Intron XP_016876981.1
XM_017021493.1 255 Intron XP_016876982.1
XM_017021494.1 255 Intron XP_016876983.1
XM_017021495.1 255 Intron XP_016876984.1
XM_017021496.1 255 Intron XP_016876985.1
XM_017021497.1 255 Intron XP_016876986.1
Gene
RNASE13
Gene Name
ribonuclease A family member 13 (inactive)
There are no transcripts associated with this gene.

Gene
TPPP2
Gene Name
tubulin polymerization promoting protein family member 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_173846.4 255 Missense Mutation ACA,AGA T44R NP_776245.2
XM_005267324.4 255 Missense Mutation ACA,AGA T44R XP_005267381.1
XM_011536416.1 255 Missense Mutation ACA,AGA T44R XP_011534718.1
XM_011536417.2 255 Missense Mutation ACA,AGA T44R XP_011534719.1
XM_011536418.1 255 Missense Mutation ACA,AGA T44R XP_011534720.1
XM_011536420.2 255 Missense Mutation ACA,AGA T44R XP_011534722.1
XM_017020966.1 255 Missense Mutation ACA,AGA T44R XP_016876455.1

View Full Product Details