Product Details

SNP ID: rs138992080
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24305671 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCGGCCCTTCTGCTGCCACTGCT[C/T]AGCCCCCTCCACTGCATGACGAAGG
Phenotype: MIM: 604441 MIM: 610410 MIM: 601531 MIM: 605773
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CIDEB PubMed Links

Gene Details

Gene: CIDEB
Gene Name: cell death-inducing DFFA-like effector b

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318807.1	1758	Missense Mutation	AAG,GAG	K208E	NP_001305736.1
NM_014430.2	1758	Missense Mutation	AAG,GAG	K208E	NP_055245.2
XM_011536659.2	1758	Missense Mutation	AAG,GAG	K208E	XP_011534961.1
XM_017021221.1	1758	Missense Mutation	AAG,GAG	K208E	XP_016876710.1

Gene: DHRS1
Gene Name: dehydrogenase/reductase 1

There are no transcripts associated with this gene.

Gene: LTB4R
Gene Name: leukotriene B4 receptor

There are no transcripts associated with this gene.

Gene: LTB4R2
Gene Name: leukotriene B4 receptor 2

There are no transcripts associated with this gene.

Gene: NOP9
Gene Name: NOP9 nucleolar protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286367.1	1758	UTR 3			NP_001273296.1
NM_174913.2	1758	UTR 3			NP_777573.1
XM_005267385.1	1758	UTR 3			XP_005267442.1
XM_011536526.1	1758	UTR 3			XP_011534828.1
XM_011536527.2	1758	Intron			XP_011534829.1

View Full Product Details